Converting a Unipro UGENE sequence to Serial Cloner
This describes how to take a sequence with annotated features and move it into Serial Cloner with your favorite text editor and minimal effort. The annotated features from Unipro UGENE will ultimately be intact and displayed in Serial Cloner if you follow this process. One of the reasons for possibly doing this is in order to take advantage of the tools in Serial Cloner that UGENE seems to lack/approaches differently, in particular Serial Cloner allows for easily making and printing full graphical Graph Maps or classical restriction sequence maps (Seq. Maps) with features and restriction sites indicated.
Step 1: locate UGENE-generated files you'll need
You'll need to find the sequence and the associated annotations that UGENE generated. How to do this requires some examination of your UGENE files. Typically when you are just starting to use UGENE, each molecule will have three files:
-
The sequence and annotations files should be together in the project folder along with your project data information file that ends in the extension
.uprj. You do not need any information from this file to perform the conversion, but examining it in your text editor or UGENE may help you identify the specific, related sequence and feature annotations files you need to do the conversion. -
The UGENE sequence will be a FASTA format sequence file ending in
.fa. You need to indentify the specific sequence file related to the specific molecule you are trying to port over to Serial Cloner. Your project folder may or may not have additional files with the same extension in it depending on how you choose to work with UGENE and its project and documents. -
The file with the feature annotations will end in
.gb. You need to identify the specific Genbank-like formatted feature annotations file related to the specific molecule you are trying to port over to Serial Cloner. Your project folder may or may not have additional files in it with the same extension depending on how you choose to work with UGENE and its project and documents.
However, when using the Cloning action under Actions to build molecules, you can alternatively just end up a Genbank-like formatted that INCLUDES BOTH the sequence and the annotations and there will be no associated .fa file. In this case you can skip over step #2 and go right to step #3.
Step 2: Prepare a 'bridging file' to be used for importing into Serial Cloner
You'll need to add the sequence from .fa file to the bottom of the .gb to make a Genbank file in a format that Serial Cloner will identify and use. The steps for that follow:
- In a good text editor equipped to handle coding, like Sublime Text, Brackets, Atom or TextWrangler (basically, anything aside from Window's Notepad, Microsoft Word, or other too basic text software/too fancy Word Processing software), open the UGENE file with the feature annotations that ends in
.gb.
It will look something like below:
LOCUS Annotations 24-JUN-2015
UNIMARK Annotations
FEATURES Location/Qualifiers
misc_feature 53..80
/note="28 nucleotides flanking insert (prefer 40)"
/ugene_name="FLANKING\ RPR1\ 28"
/ugene_group="RPR1_portions"
primer 53..73
/note="OMES-P1 primer, fwd primer for RPR1 region of
yeast genome"
/ugene_name="OMES-P1"
/ugene_group="RPR1_portions"
misc_feature 99..128
/note="ADH1p FWD PRIMER H911"
/ugene_name="ADH1p\ FWD\ PRIMER\ H911"
/ugene_group="ADH1p\ and\ t"
promoter 109..876
/note="Saccharomyces cerevisiae S288c chromosome XV"
/ugene_name="ADH1\ promoter"
/ugene_group="ADH1p\ and\ t"
misc_feature 851..893
/note="ADH1p REV PRIMER"
/ugene_name="ADH1p\ REV\ PRIMER\ H912"
/ugene_group="ADH1p\ and\ t"
misc_feature 890..2447
/note="portion of DNA from Arabidopsis with PRORP3 on it"
/ugene_name="PRORP3\ region"
/ugene_group="PRORP3"
gene 892..2445
/note="Arabidopsis thaliana PRORP3 gene"
/ugene_name="PRORP3"
terminator 2482..2797
/note="ADH1 terminator from S cerevisiae"
/ugene_name="ADH1\ terminator"
/ugene_group="ADH1p\ and\ t"
misc_feature 2877..2988
/note="112 NUCLEOTIDES FLANKING RPR1 GENE"
/ugene_name="FLANKING\ RPR1\ 112"
/ugene_group="RPR1_portions"
primer_bind 2975..2988
/note="part of OMES-2, primer, rev primer for RPR1 region
of yeast genome"
/ugene_name="OMES-P2\ part"
/ugene_group="RPR1_portions"
//
-
So that you don't destroy your UGENE files and projects, immediately save the
.gbfile as another name, preferably in a new directory. Once it is saved you are ready to edit it safely. -
The sequence will be placed right before the
//found at the end of the.gbgile. The sequence has to be prefixed by a signal. Therefore on the line just above//, typeORIGINand hit return. Now that you have theORIGINsignal that indicates a sequence follows, you are ready to paste in the sequence on the next line. - Open in a text editor the sequence
.fafile identified above and copy the sequence portion and then paste it on the line afterORIGINin the bridging.gbfile you are making.
When the last two steps are completed you now should have something looking like below:
LOCUS Annotations 24-JUN-2015
UNIMARK Annotations
FEATURES Location/Qualifiers
misc_feature 53..80
/note="28 nucleotides flanking insert (prefer 40)"
/ugene_name="FLANKING\ RPR1\ 28"
/ugene_group="RPR1_portions"
primer 53..73
/note="OMES-P1 primer, fwd primer for RPR1 region of
yeast genome"
/ugene_name="OMES-P1"
/ugene_group="RPR1_portions"
misc_feature 99..128
/note="ADH1p FWD PRIMER H911"
/ugene_name="ADH1p\ FWD\ PRIMER\ H911"
/ugene_group="ADH1p\ and\ t"
promoter 109..876
/note="Saccharomyces cerevisiae S288c chromosome XV"
/ugene_name="ADH1\ promoter"
/ugene_group="ADH1p\ and\ t"
misc_feature 851..893
/note="ADH1p REV PRIMER"
/ugene_name="ADH1p\ REV\ PRIMER\ H912"
/ugene_group="ADH1p\ and\ t"
misc_feature 890..2447
/note="portion of DNA from Arabidopsis with PRORP3 on it"
/ugene_name="PRORP3\ region"
/ugene_group="PRORP3"
gene 892..2445
/note="Arabidopsis thaliana PRORP3 gene"
/ugene_name="PRORP3"
terminator 2482..2797
/note="ADH1 terminator from S cerevisiae"
/ugene_name="ADH1\ terminator"
/ugene_group="ADH1p\ and\ t"
misc_feature 2877..2988
/note="112 NUCLEOTIDES FLANKING RPR1 GENE"
/ugene_name="FLANKING\ RPR1\ 112"
/ugene_group="RPR1_portions"
primer_bind 2975..2988
/note="part of OMES-2, primer, rev primer for RPR1 region
of yeast genome"
/ugene_name="OMES-P2\ part"
/ugene_group="RPR1_portions"
ORIGIN
GGGCGAATTGGGCCCGACGTCGCATGCTCCCGGCCGCCATGGCCGCGGGATTACTCTGGGAGCTGCGATTGGCAGTGGAAGCTTCGTACGGCCAGTGAATTCGAGCTCCCCCTCCGCGCTCTTTTCCGATTTTTTTCTAAACCGTGGAATATTTCGGATATCCTTTTGTTGTTTCCGGGTGTACAATATGGACTTCCTCTTTTCTGGCAACCAAACCCATACATCGGGATTCCTATAATACCTTCGTTGGTCTCCCTAACATGTAGGTGGCGGAGGGGAGATATACAATAGAACAGATACCAGACAAGACATAATGGGCTAAACAAGACTACACCAATTACACTGCCTCATTGATGGTGGTACATAACGAACTAATACTGTAGCCCTAGACTTGATAGCCATCATCATATCGAAGTTTCACTACCCTTTTTCCATTTGCCATCTATTGAAGTAATAATAGGCGCATGCAACTTCTTTTCTTTTTTTTTCTTTTCTCTCTCCCCCGTTGTTGTCTCACCATATCCGCAATGACAAAAAAATGATGGAAGACACTAAAGGAAAAAATTAACGACAAAGACAGCACCAACAGATGTCGTTGTTCCAGAGCTGATGAGGGGTATCTCGAAGCACACGAAACTTTTTCCTTCCTTCATTCACGCACACTACTCTCTAATGGGCAACGGTATACGGCCTTCCTTCCAGTTACTTGAATTTGAAATAAAAAAAAGTTTGCTGTCTTGCTATCAAGTATAAATAGACCTGCAATTATTAATCTTTTGTTTCCTCGTCATTGTTCTCGTTCCCTTTCTTCCTTGTTTCTTTTTCTGCACAATATTTCAAGCTATACCAAGCATACAATCAACTATCTCATATACACCCGGATTCTAGACCATGGCTGGTACTGATAACCGCCGCTCTCGCCACGACGACGAAAGCCCTAAAAATCCCAACAAGAAGAAGAAAGGAAACCGTAATCCAGAAAAGAGTCTCCTTATCAATCTTCATTCATGTTCCAAGAGAAAGGATCTCTCAGCTGCATTGGCTCTTTATGATGCAGCTATCACTTCCAGTGACATTCGCCTCAACCAGCAACACTTCCAATCCCTTCTTTACCTCTGCTCCGCGTTCATTAGTGACCCATCTCTTCAAACCGTTGCCATTGACCGTGGCTTTCAAATTTTTGACCGTATGGTTAGTTCTGGGATAAGTCCTAATGAATCATCTGTCACTGCAGTTGCACGACTAGCTGCTGCCAAGGGTGATGGAGACTATGCTTTCAAGCTTGTTAAAGACCTTGTTGCTGTTGGTGGTGTATCGGTCCCTCGTCTGAGAACTTATGCTCCGGCTTTGCTCTGTTTCTGTGATACTTTGGAGGCTGAAAAGGGTTATGAAGTGGAAGATCACATGGATGCTTCAGGTATTGTGTTGGAGGAGGCAGAGATCTCGGCTTTGCTAAAGGTAAGCGCTGCCACAGGCCGAGAAAACAAGGTTTATAGATATCTGCAGAAGTTAAGAGAATGTGTTGGCTGCGTTAGTGAAGAAACTTCAAAAGCAATCGAGGAATGGTTTTATGGAGTGAAAGCTAGCGAAGTTAGTGATAATGGGATTGGTTCTGATATTGAGCTGCTTAGAGCAGCTGTTTTGAAAAATGGGGGTGGGTGGCATGGTCTTGGGTGGGTTGGAGAAGGCAAATGGATTGTGAAGAAAGGTAATGTTAGCTCAGCCGGGAAATGTTTGAGCTGTGATGAGCATTTGGCTTGTGTTGATACCAATGAGGTAGAGACTGAAGATTTTGTGAATTCTTTGGTGACTTTGGCTATGGAGAGGAAGGCAAAGATGAATTCATGCGAGCCTATGGCGGATTTCAGTGAGTTTCAGGAGTGGCTTGAAAAGCATGGAGATTACGAAGCTATACTAGATGGAGCAAATATTGGGCTCTACCAACAAAATTTTGCAGATGGTGGTTTCAGTCTACCACAGCTTGAAGCTGTAGTGAAGGAACTTTACAATAAAAGTGGTAGCAAAAAACAGCCGCTAATTCTCTTGCACAAGAAACGGGTCAATGCGCTTTTAGAAAACCCGAATCACCGGAATCTTGTGGAAGAATGGATTAATAACAATGTCCTGTATGCGACTCCACCAGGTTCCAATGATGATTGGTATTGGCTCTACGCTGCTGCTAAACTCAAGTGTTTACTTGTGACTAATGATGAGATGAGAGATCACATTTTTGAACTATTAAGTAACAGTTTCTTCCAAAAATGGAAAGAAAGACATCAAGTTCGGTTTACCTTTGTGAAAGGCTGTCTCAAGCTTGAAATGCCACCTCCTTTTTCAGTTGTGATCCAGGAATCGGAGAAAGGATCATGGCACGTTCCAATCACGAGTCAAGACAAGGAGGAATCTTTAAGAAGTTGGATGTGCATTACAAGGCAGAGTTCATAGATGCAGGCATGCAAGCTTGGCGTAATCATGGTACCGGCGAATTTCTTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTCTTAGGTTTTAAAACGAAAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTTATTGACCACACCTCTACCGGCATGCCGAGCAAATGCCTGCAAATCGCTCCCCATTTCACCCAATTGTAGATATGCTAACTCCAGCAATGAGTTGATGAATCTCGGTGTGTATTTTATGTCCTCAGAGGACAACACCTGTTGTAATCGAGCTCGACAACCCTTAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTGATATCAGATCCACTAGTGGCCTCAATCGTAGGACGTCATTAGTGGCGAACCCGATACCGATTACTGCTGCTGTTCCAGCCCATATCCAACTTCCAATTTAATCTTTCTTTTTTAATTTTCACTTATTTGCGATAATCACTAGTGCGGCCGCCTGCAGGTCGACCATATGGGAGAGCTCCCAACGCGTTGGATGCATAGCTTGAGTATTCTATAGTGTCACCTAAATAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATA
//
-
Save the 'bridging'
.gbintermediate file and close it. -
Optional: At this point, you can run a Python script to modify the annotation names in the 'bridging'
.gbintermediate file to facilitate the conversion of the UGENE annotations into Serial Cloner features. (Very soon you'll have the option to paste the text of the 'bridging'.gbintermediate file into a webserver to do the modification.) This step can save you editing the feature names at the end of step #4 below.
Step 3: Bring the sequence and annotations into Serial Cloner
-
Right click the combined
.gband select to open it in Serial Cloner. -
It will give a message that you imported a NCBI-formatted Genbank file.
-
Your full sequence should be there. As a verification of the process thus far, it is advised you confirm the length matches.
-
Toggle on
circularoption in theSequencetab if the sequence is a plasmid.
Step 4: Enable the imported annotated features to show in Serial Cloner and Fix names
You most likely will not need to adjust the features to show if your UGENE .gb file had already contained both annotations and the sequence. For whatever reason files already containing the sequence, seem to default to enabling show on the individual features.
-
Go to the
Featurestab and clickEditin the bottom right corner of the features window so you can toggle onShow. -
Toggle on
Showin the bottom left so all the features will show in Serial Cloner tools. The will become bold text whenshowis enabled. (Sadly, you have to do them one by one. I have not found a way to selected all of them at once.) -
Adjust the names of the features as you see fit. (Serial Cloner is taking the first part of the text that was in the notes and appending it to the type of feature and so the names may not be as you'd like upon import. I have developed a Python script to automatically adjust this ahead of time by altering the
.gbbridging file just prior to the current step #3. I also plan to host a webserver version of this helpful aid soon. Please look into one of these options if you find you are doing this tedious adjustment a lot.)
Step 5: Save as Serial Cloner '.xdna' format and clean up
-
Save the file so you can open it in Serial Cloner later without needing to repeat all these steps. It is advised that you save it in a manner to clearly distinguishable from the UGENE files, optionally even in a separate folder. Helpful tip: The saved file will end in the Serial cloner
.xdnaextension, and so if you have extensions viewable it should still be distinguishable even if the file name or folder doesn't clearly indicate. -
Now you can make and print
Graph MapsorSeq. Mapsusing the tool bar buttons in Serial Cloner and the imported features will be visible. -
You should delete the intermediate, 'bridging file' at this point to avoid confusion later.
Additional notes
There is a separate Serial Cloner Genbank format that Serial Cloner can save and import. This format includes color and other information in the features list. You could optionally take advantage of this ability and add related code if you want at step #2. I considered made a Python script to do at least one of these optional steps and considered developig more. Overall though the process as described here is relatively straightforward and seems acceptable for now.